Skip to main content

pBES2
(Plasmid #83800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83800 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDH22
  • Backbone manufacturer
    Muller Lab, Addgene plasmid #83798
  • Modifications to backbone
    YFP has been mutated to the Venus variant
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Venus

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TEF-terminator-F, CCCAGATGCGAAGTTAAGTG
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information, see http://yeastrc.org/yeastrc/pages/plasmids_protocols.html
Venus mutations are described in "A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications" by Nagai, Ibata, Park, Kubota, Mikoshiba and Miyawaki in Nat Biotechnol 2002;20:87-90. In addition we have included Q69M, a mutation briefly mentioned in the Nagai et al. paper as potentially beneficial, although not necessary for the enhanced maturation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBES2 was a gift from Eric Muller (Addgene plasmid # 83800 ; http://n2t.net/addgene:83800 ; RRID:Addgene_83800)
  • For your References section:

    Fluorescence resonance energy transfer using color variants of green fluorescent protein. Hailey DW, Davis TN, Muller EG. Methods Enzymol. 2002;351:34-49. PubMed 12073355
Commonly requested with: