pPJ168(JPUB_006767)
(Plasmid
#83832)
-
PurposeCarries NEW operon 4 final
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbE0k backbone (colE1 ori, kanR)
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium Copy
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameKuste2802
-
Alt nameACP synthase
-
Insert Size (bp)414
- Promoter op4_BsaI_2802_for
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aattccgaattcatgagatctggatcggtctcaatggttcgcatctacatgttcatcg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKuste2805
-
Alt namenon-canonical FabB
-
Insert Size (bp)1236
- Promoter op4_2805_for
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gtaaaggaggttttctaatgaaaaaacgcgtggttattacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPJ168(JPUB_006767) was a gift from Harry Beller (Addgene plasmid # 83832 ; http://n2t.net/addgene:83832 ; RRID:Addgene_83832) -
For your References section:
Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli. Javidpour P, Deutsch S, Mutalik VK, Hillson NJ, Petzold CJ, Keasling JD, Beller HR. PLoS One. 2016 Mar 14;11(3):e0151087. doi: 10.1371/journal.pone.0151087. eCollection 2016. PONE-D-16-02052 [pii] PubMed 26975050