Skip to main content

mKO2-SLBP(18-126)
(Plasmid #83914)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83914 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.7m
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 7426
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKO2-SLBP(18-126)
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1035
  • Entrez Gene
    SLBP (a.k.a. HBP)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agctggtttagtgaaccgtcagatc
  • 3′ sequencing primer ggaaccggaacccttaaaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mKO2-SLBP(18-126) was a gift from Michael Lin (Addgene plasmid # 83914 ; http://n2t.net/addgene:83914 ; RRID:Addgene_83914)
  • For your References section:

    Fluorescent indicators for simultaneous reporting of all four cell cycle phases. Bajar BT, Lam AJ, Badiee RK, Oh YH, Chu J, Zhou XX, Kim N, Kim BB, Chung M, Yablonovitch AL, Cruz BF, Kulalert K, Tao JJ, Meyer T, Su XD, Lin MZ. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4045. 10.1038/nmeth.4045 PubMed 27798610