-
PurposeFluorescent probe for M/G1 transition
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.7m
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 7475
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameClover-Geminin(1-110)
-
SpeciesSynthetic
-
Insert Size (bp)1080
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agctggtttagtgaaccgtcagatc
- 3′ sequencing primer ggaaccggaacccttaaaca
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Clover-Geminin(1-110) was a gift from Michael Lin (Addgene plasmid # 83915 ; http://n2t.net/addgene:83915 ; RRID:Addgene_83915) -
For your References section:
Fluorescent indicators for simultaneous reporting of all four cell cycle phases. Bajar BT, Lam AJ, Badiee RK, Oh YH, Chu J, Zhou XX, Kim N, Kim BB, Chung M, Yablonovitch AL, Cruz BF, Kulalert K, Tao JJ, Meyer T, Su XD, Lin MZ. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4045. 10.1038/nmeth.4045 PubMed 27798610