pET32bplus_trxAChEwt
(Plasmid
#83916)
-
PurposeEncodes an E. coli codon optimized version of wild type human acetylcholinesterase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET32b+
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5848
- Total vector size (bp) 7501
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameShort form of hAChE, codon optimised for E.coli expression
-
Alt namehAChE-wt
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1653
-
Mutationcodon optimised for E.coli expression
-
GenBank IDM55040.1
-
Entrez GeneACHE (a.k.a. ACEE, ARACHE, N-ACHE, YT)
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- TRX (N terminal on backbone)
- His (N terminal on backbone)
- S-tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer aaattcgaacgccagcacatgg
- 3′ sequencing primer caaaaaacccctcaagacccg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET32bplus_trxAChEwt was a gift from Sarel Fleishman (Addgene plasmid # 83916 ; http://n2t.net/addgene:83916 ; RRID:Addgene_83916) -
For your References section:
Automated Structure- and Sequence-Based Design of Proteins for High Bacterial Expression and Stability. Goldenzweig A, Goldsmith M, Hill SE, Gertman O, Laurino P, Ashani Y, Dym O, Unger T, Albeck S, Prilusky J, Lieberman RL, Aharoni A, Silman I, Sussman JL, Tawfik DS, Fleishman SJ. Mol Cell. 2016 Jul 21;63(2):337-46. doi: 10.1016/j.molcel.2016.06.012. Epub 2016 Jul 14. 10.1016/j.molcel.2016.06.012 PubMed 27425410