Skip to main content

pP{ELAV-GeneSwitch}
(Plasmid #83957)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83957 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUAST
  • Total vector size (bp) 14502
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    fusion protein consisting of the GAL4-DBD, human progesterone receptor-ligand-binding domain, and P65-AD
  • Alt name
    GeneSwitch
  • Species
    H. sapiens (human), S. cerevisiae (budding yeast)
  • Entrez Gene
    GAL4 (a.k.a. YPL248C, GAL81)
  • Entrez Gene
    RELA (a.k.a. AIF3BL3, CMCU, NFKB3, p65)
  • Promoter elav

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aattaaccctcactaaaggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pP{ELAV-GeneSwitch} was a gift from Haig Keshishian (Addgene plasmid # 83957 ; http://n2t.net/addgene:83957 ; RRID:Addgene_83957)
  • For your References section:

    A conditional tissue-specific transgene expression system using inducible GAL4. Osterwalder T, Yoon KS, White BH, Keshishian H. Proc Natl Acad Sci U S A. 2001 Oct 23;98(22):12596-601. 10.1073/pnas.221303298 PubMed 11675495