-
PurposeExpresses conditional RU486-dependent GAL4 protein under control of the elav promotor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUAST
- Total vector size (bp) 14502
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefusion protein consisting of the GAL4-DBD, human progesterone receptor-ligand-binding domain, and P65-AD
-
Alt nameGeneSwitch
-
SpeciesH. sapiens (human), S. cerevisiae (budding yeast)
-
Entrez GeneGAL4 (a.k.a. YPL248C, GAL81)
-
Entrez GeneRELA (a.k.a. AIF3BL3, CMCU, NFKB3, p65)
- Promoter elav
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer aattaaccctcactaaaggg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pP{ELAV-GeneSwitch} was a gift from Haig Keshishian (Addgene plasmid # 83957 ; http://n2t.net/addgene:83957 ; RRID:Addgene_83957) -
For your References section:
A conditional tissue-specific transgene expression system using inducible GAL4. Osterwalder T, Yoon KS, White BH, Keshishian H. Proc Natl Acad Sci U S A. 2001 Oct 23;98(22):12596-601. 10.1073/pnas.221303298 PubMed 11675495