pCFD4d-U6-1:white1-U6-3:white1
(Plasmid
#84005)
-
PurposepCFD4d expresses white sgRNA-1 from a U6:3 promoter and the same white sgRNA-1 from a U6:1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCFD4d
- Backbone size w/o insert (bp) 4575
- Total vector size (bp) 4579
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namewhite sgRNA-1
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)20
- Promoter U6:3
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATTCCTATCCGGCGGTAGTC
- 3′ sequencing primer TGTACGTCAACGGAAAACCA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namewhite sgRNA-1
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)20
- Promoter U6:1
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATTCCTATCCGGCGGTAGTC
- 3′ sequencing primer TGTACGTCAACGGAAAACCA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD4d-U6-1:white1-U6-3:white1 was a gift from Phillip Zamore (Addgene plasmid # 84005 ; http://n2t.net/addgene:84005 ; RRID:Addgene_84005) -
For your References section:
Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-conversion. Ge DT, Tipping C, Brodsky MH, Zamore PD. G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557. 10.1534/g3.116.032557 PubMed 27543296