Skip to main content

act-AsCpf1
(Plasmid #73917)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73917 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pact
  • Backbone manufacturer
    gift from Silvia Aldaz
  • Backbone size w/o insert (bp) 12429
  • Total vector size (bp) 16571
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hAsCpf1
  • Alt name
    human codon-optimized AsCas12a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4059
  • Promoter act5C
  • Tag / Fusion Protein
    • NLS-3xHA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTCTACATTACCAAATAAGG
  • 3′ sequencing primer AAATCTCTGTAGGTAGTTTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hAsCpf1 from Feng Zhang (Addgene plasmid 69982).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit crisprflydesign.org for more information.

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    act-AsCpf1 was a gift from Simon Bullock (Addgene plasmid # 73917 ; http://n2t.net/addgene:73917 ; RRID:Addgene_73917)
  • For your References section:

    Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Port F, Bullock SL. Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5. 10.1038/nmeth.3972 PubMed 27595403