-
Purposetissue-specific multiplex gRNA plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBIC-UASC
-
Backbone manufacturerBrian McCabe
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name:tRNA:gRNA:tRNA:gRNA:tRNA
-
gRNA/shRNA sequenceempty
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)750
- Promoter UAS-DSCP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAATGAATGTTCGAGCCGAGC
- 3′ sequencing primer AAATCTCTGTAGGTAGTTTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.
Visit crisprflydesign.org for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD6 was a gift from Simon Bullock (Addgene plasmid # 73915 ; http://n2t.net/addgene:73915 ; RRID:Addgene_73915) -
For your References section:
Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Port F, Bullock SL. Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5. 10.1038/nmeth.3972 PubMed 27595403