Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCFD6
(Plasmid #73915)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73915 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBIC-UASC
  • Backbone manufacturer
    Brian McCabe
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    :tRNA:gRNA:tRNA:gRNA:tRNA
  • gRNA/shRNA sequence
    empty
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    750
  • Promoter UAS-DSCP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAATGAATGTTCGAGCCGAGC
  • 3′ sequencing primer AAATCTCTGTAGGTAGTTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.

Visit crisprflydesign.org for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD6 was a gift from Simon Bullock (Addgene plasmid # 73915 ; http://n2t.net/addgene:73915 ; RRID:Addgene_73915)
  • For your References section:

    Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Port F, Bullock SL. Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5. 10.1038/nmeth.3972 PubMed 27595403