Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCFD3-dU6:3gRNA
(Plasmid #49410)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49410 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pValium22
  • Backbone manufacturer
    Norbert Perrimon, Jian-Quan Ni, Harvard
  • Total vector size (bp) 6248
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dU6-3:gRNA
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    750
  • Promoter dU6-3

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ACCTACTCAGCCAAGAGGC
  • 3′ sequencing primer TGCATACGCATTAAGCGAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Fillip Port, Simon Bullock lab, MRC-LMB
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.

Visit crisprflydesign.org for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD3-dU6:3gRNA was a gift from Simon Bullock (Addgene plasmid # 49410 ; http://n2t.net/addgene:49410 ; RRID:Addgene_49410)
  • For your References section:

    Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Port F, Chen HM, Lee T, Bullock SL. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500. 10.1073/pnas.1405500111 PubMed 25002478