Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62209)


Item Catalog # Description Quantity Price (USD)
Plasmid 62209 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    gift from Silvia Aldaz
  • Backbone size w/o insert (bp) 12429
  • Total vector size (bp) 16571
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Promoter act5C

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTAGACCAGCGCAGTCCAAGG
  • 3′ sequencing primer TAGAGCTTTAAATCTCTGTAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hCas9 from George Church (Addgene plasmid 41815).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

Please visit for more information.

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAct-Cas9 was a gift from Simon Bullock (Addgene plasmid # 62209 ; ; RRID:Addgene_62209)
  • For your References section:

    Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Port F, Chen HM, Lee T, Bullock SL. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500. 10.1073/pnas.1405500111 PubMed 25002478