-
PurposeExpresses Cas9 under control of nanos promoter and 3'UTR. For germ line restricted genome engineering in Drosophila melanogaster.
-
Depositing Lab
-
Depositing OrganizationMRC Laboratory of Molecular Biology
Located in United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepnos
-
Backbone manufacturerJohannes Bischof and Konrad Basler
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 13353
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecas9
- Promoter nanos
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATAAAGAAGTATCGCGAATAC
- 3′ sequencing primer TTACTATCTATCTGGTTAACCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhCas9 from George Church (Addgene plasmid 41815). pnos backbone from Johannes Bischof and Konrad Basler.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit crisprflydesign.org for more information.
Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pnos-Cas9-nos was a gift from Simon Bullock (Addgene plasmid # 62208 ; http://n2t.net/addgene:62208 ; RRID:Addgene_62208) -
For your References section:
Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Port F, Chen HM, Lee T, Bullock SL. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500. 10.1073/pnas.1405500111 PubMed 25002478