Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73916)


Item Catalog # Description Quantity Price (USD)
Plasmid 73916 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Norbert Perrimon, Jian-Quan Ni, Harvard
  • Total vector size (bp) 6248
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • gRNA/shRNA sequence
  • Species
    H. sapiens (human), D. melanogaster (fly)
  • Promoter dU6:3

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGTTTTATAACTTATGCCCCTAAG
  • 3′ sequencing primer GCCGAGCACAATTGTCTAGAATGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.

Visit for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD7 was a gift from Simon Bullock (Addgene plasmid # 73916 ; ; RRID:Addgene_73916)
  • For your References section:

    Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Port F, Bullock SL. Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5. 10.1038/nmeth.3972 PubMed 27595403