pUB6_EPB49
(Plasmid
#84015)
-
PurposeEPB49 minigene to test splicing event
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUB6/V5-HisA
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 9268
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEPB49
-
SpeciesH. sapiens (human)
-
Insert Size (bp)576
-
Entrez GeneDMTN (a.k.a. DMT, EPB49)
- Promoter UB6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAGTGTTAGACTAGTAAAT
- 3′ sequencing primer TCGAAGGGCCCTCTAGACTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUB6_EPB49 was a gift from Robert Bradley (Addgene plasmid # 84015 ; http://n2t.net/addgene:84015 ; RRID:Addgene_84015) -
For your References section:
U2AF1 mutations alter splice site recognition in hematological malignancies. Ilagan JO, Ramakrishnan A, Hayes B, Murphy ME, Zebari AS, Bradley P, Bradley RK. Genome Res. 2015 Jan;25(1):14-26. doi: 10.1101/gr.181016.114. Epub 2014 Sep 29. 10.1101/gr.181016.114 PubMed 25267526