Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUB6_EPB49
(Plasmid #84015)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84015 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUB6/V5-HisA
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 9268
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EPB49
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    576
  • Entrez Gene
    DMTN (a.k.a. DMT, EPB49)
  • Promoter UB6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAGTGTTAGACTAGTAAAT
  • 3′ sequencing primer TCGAAGGGCCCTCTAGACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUB6_EPB49 was a gift from Robert Bradley (Addgene plasmid # 84015 ; http://n2t.net/addgene:84015 ; RRID:Addgene_84015)
  • For your References section:

    U2AF1 mutations alter splice site recognition in hematological malignancies. Ilagan JO, Ramakrishnan A, Hayes B, Murphy ME, Zebari AS, Bradley P, Bradley RK. Genome Res. 2015 Jan;25(1):14-26. doi: 10.1101/gr.181016.114. Epub 2014 Sep 29. 10.1101/gr.181016.114 PubMed 25267526