Skip to main content
Holiday Schedule: Addgene will be closed November 25th & 26th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRRL_U2AF1_WT_mCherry
(Plasmid #84017)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84017 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK-GFP.WPRE
  • Backbone manufacturer
    Didier Trono (Addgene plasmid # 12252)
  • Backbone size w/o insert (bp) 6651
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U2AF1
  • Alt name
    U2 small nuclear RNA auxiliary factor 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1515
  • Entrez Gene
    U2AF1 (a.k.a. FP793, RN, RNU2AF1, U2AF35, U2AFBP)
  • Promoter PGK
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • T2A-mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ggggttggggttgcgccttt (hPGK)
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL_U2AF1_WT_mCherry was a gift from Robert Bradley (Addgene plasmid # 84017 ; http://n2t.net/addgene:84017 ; RRID:Addgene_84017)
  • For your References section:

    U2AF1 mutations alter splice site recognition in hematological malignancies. Ilagan JO, Ramakrishnan A, Hayes B, Murphy ME, Zebari AS, Bradley P, Bradley RK. Genome Res. 2015 Jan;25(1):14-26. doi: 10.1101/gr.181016.114. Epub 2014 Sep 29. 10.1101/gr.181016.114 PubMed 25267526