Skip to main content
Addgene

pHD157
(Plasmid #84033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84033 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Vector type
    Cre/Lox ; Zebrafish transgenesis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cre
  • Promoter fabp10
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Venus
  • Promoter Crystalin

Cloning Information for Gene/Insert 2

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Designed in a pBluescript series vector containing I-SceI meganuclease sites. The I-SceI meganuclease method is a common method for establishing transgenic zebrafish lines.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHD157 was a gift from Daniel Hesselson & Didier Stainier (Addgene plasmid # 84033 ; http://n2t.net/addgene:84033 ; RRID:Addgene_84033)
  • For your References section:

    Conditional control of gene function by an invertible gene trap in zebrafish. Ni TT, Lu J, Zhu M, Maddison LA, Boyd KL, Huskey L, Ju B, Hesselson D, Zhong TP, Page-McCaw PS, Stainier DY, Chen W. Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15389-94. Epub 2012 Aug 20. 10.1073/pnas.1206131109 PubMed 22908272