Skip to main content

Osa-pCAMBIA-1301-STTM396
(Plasmid #84206)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84206 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAMBIA-1301
  • Backbone manufacturer
    CAMBIA Company
  • Backbone size w/o insert (bp) 11827
  • Vector type
    Bacterial Expression, Yeast Expression, Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR396
  • Alt name
    Osa-miR396
  • Species
    Rice
  • Insert Size (bp)
    2846
  • GenBank ID
    miRBase (MI0001046-MI0001048, MI0013047-MI0013049, MI0001703, MI0010563)
  • Promoter 2x35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer 35S promoter
  • 3′ sequencing primer AGGTTTAGTCGTCTCGTGTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid used to disturb miR396’s expression by STTM method invented by Dr. Guiliang Tang’s Lab in Michigan Technological University (Plant cell, 2012), Houghton, MI, USA. The method used to construct this plasmid refers to Tang et al., (Methods, 2012) with minor revision. The STTM sequence in this plasmid may contain discrepancies compared to the reference sequence(s). According to the depositing lab, these mutations should not affect plasmid function. For additional published information regarding this plasmid, please see https://www.cell.com/molecular-plant/pdf/S1674-2052(18)30275-2.pdf?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1674205218302752%3Fshowall%3Dtrue#

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Osa-pCAMBIA-1301-STTM396 was a gift from Guiliang Tang (Addgene plasmid # 84206 ; http://n2t.net/addgene:84206 ; RRID:Addgene_84206)
  • For your References section:

    Effective small RNA destruction by the expression of a short tandem target mimic in Arabidopsis. Yan J, Gu Y, Jia X, Kang W, Pan S, Tang X, Chen X, Tang G. Plant Cell. 2012 Feb;24(2):415-27. doi: 10.1105/tpc.111.094144. Epub 2012 Feb 17. 10.1105/tpc.111.094144 PubMed 22345490
Commonly requested with: