Skip to main content
Addgene

Rhesus AAVS1-CAG-copGFP
(Plasmid #84209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84209 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAVS1P-iCAG.copGFP (Plasmid #66577)
  • Total vector size (bp) 10499
  • Modifications to backbone
    The human AAVS1 homology arms were replaced with rhesus homologous sequences.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Rhesus AAVS1 5’ homology arm
  • Species
    rhesus macaque (Macaca mulatta)
  • Insert Size (bp)
    700
  • GenBank ID
    N/A (Chromosome 19:61115597-61116296, the MGSC Merged 1.0/rheMac2 assembly)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (destroyed during cloning)
  • 3′ cloning site NotI (destroyed during cloning)
  • 5′ sequencing primer tatgaccatgattacgccgccacctccttcaggttccagcttcct
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Rhesus AAVS1 3’ homology arm
  • Species
    rhesus macaque (Macaca mulatta)
  • Insert Size (bp)
    700
  • GenBank ID
    N/A (Chromosome 19:61114897-61115596, the MGSC Merged 1.0/rheMac2 assembly)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (destroyed during cloning)
  • 3′ cloning site PmeI (destroyed during cloning)
  • 5′ sequencing primer agtcagtgagaatattgtttgactggtgacaaaaagccccatcct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Rhesus AAVS1-CAG-copGFP was a gift from Cynthia Dunbar (Addgene plasmid # 84209 ; http://n2t.net/addgene:84209 ; RRID:Addgene_84209)