pGEX4T-Mst2 SARAH
(Plasmid
#84298)
-
PurposeExpresses Mst2 SARAH domain for interaction and spectroscopy studies.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-4T
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4969
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMst2
-
Alt nameStk3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)162
-
MutationL443W
-
Entrez GeneSTK3 (a.k.a. KRS1, MST2)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5'd[GGGCTGGCAAGCCACGTTTGGTG]3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To produce SARAH domain for interaction studies. Has a Trp residue for spectroscopy studies
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T-Mst2 SARAH was a gift from Jonathan Chernoff (Addgene plasmid # 84298 ; http://n2t.net/addgene:84298 ; RRID:Addgene_84298) -
For your References section:
H-ras Inhibits the Hippo Pathway by Promoting Mst1/Mst2 Heterodimerization. Rawat SJ, Araiza-Olivera D, Arias-Romero LE, Villamar-Cruz O, Prudnikova TY, Roder H, Chernoff J. Curr Biol. 2016 Jun 20;26(12):1556-63. doi: 10.1016/j.cub.2016.04.027. Epub 2016 May 26. 10.1016/j.cub.2016.04.027 PubMed 27238285