CyRFP1-C1
(Plasmid
#84354)
-
PurposeExpresses CyRFP1 fluorescent protein in an empty backbone
-
Depositing Lab
-
Depositing OrganizationMax Planck Florida Institute
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84354 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 84354-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 84354-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneEGFP-C1
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4724
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCyRFP1
-
SpeciesSynthetic
-
Insert Size (bp)702
-
MutationH61M (compared with CyOFP)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cggtgggaggtctatataagc
- 3′ sequencing primer TGATCAGTTATCTAGATCCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 84354-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 84354-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CyRFP1-C1 was a gift from Ryohei Yasuda (Addgene plasmid # 84354 ; http://n2t.net/addgene:84354 ; RRID:Addgene_84354) -
For your References section:
Simultaneous dual-color fluorescence lifetime imaging with novel red-shifted fluorescent proteins. Laviv T, Kim BB, Chu J, Lam AJ, Lin MZ, Yasuda R. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4046. 10.1038/nmeth.4046 PubMed 27798609
