pSF4 TET CMV intron renilla 24xPP7 24xMS2
(Plasmid
#84444)
-
PurposeTRICK co-localization control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSF4
-
Vector typeMammalian Expression, Luciferase ; FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerenilla - 24xPP7+24xMS2
-
SpeciesSynthetic
-
Insert Size (bp)3901
- Promoter TET+CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer Cgagacagagaagactcttgc
- 3′ sequencing primer ggttacaaataaggcaatagc
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF4 TET CMV intron renilla 24xPP7 24xMS2 was a gift from Jeffrey Chao (Addgene plasmid # 84444) -
For your References section:
Detection of the First Round of Translation: The TRICK Assay. Voigt F, Eglinger J, Chao JA. Methods Mol Biol. 2018;1649:373-384. doi: 10.1007/978-1-4939-7213-5_25. 10.1007/978-1-4939-7213-5_25 PubMed 29130211