Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-CAG-FLEX-rc [Chronos-tdTomato]
(Plasmid #84484)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84484 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV with CAG promter
  • Backbone manufacturer
    Epoch
  • Backbone size w/o insert (bp) 4906
  • Total vector size (bp) 7327
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Chronos-tdTomato
  • Alt name
    Stigeoclonium helveticum channelrhodopsin-GFP
  • Alt name
    ChR90-tdTomato
  • Species
    Stigeoclonium helveticum
  • Insert Size (bp)
    2421
  • GenBank ID
    KF992040
  • Promoter CAG
  • Tag / Fusion Protein
    • tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer gtgaccggcggctctagagc
  • 3′ sequencing primer cattaaagcagcgtatccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-FLEX-rc [Chronos-tdTomato] was a gift from Edward Boyden (Addgene plasmid # 84484 ; http://n2t.net/addgene:84484 ; RRID:Addgene_84484)
  • For your References section:

    Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633