pU2T2U2T2-YFP
(Plasmid
#84550)
-
PurposeHybrid reporter construct with 8 transcription factor binding sites (2 UAS, 2 TetO, 2 UAS, 2 TetO) driving EYFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBI
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3722
- Total vector size (bp) 4750
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU2T2U2T2-EYFP
-
SpeciesSynthetic
-
Insert Size (bp)1029
- Promoter CMV-min
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gcaatagcatcacaaatttc
- 3′ sequencing primer cccataatttttggcagagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU2T2U2T2-YFP was a gift from Joshua Leonard (Addgene plasmid # 84550 ; http://n2t.net/addgene:84550 ; RRID:Addgene_84550) -
For your References section:
Multiplexing Engineered Receptors for Multiparametric Evaluation of Environmental Ligands. Hartfield RM, Schwarz KA, Muldoon JJ, Bagheri N, Leonard JN. ACS Synth Biol. 2017 Nov 17;6(11):2042-2055. doi: 10.1021/acssynbio.6b00279. Epub 2017 Aug 23. 10.1021/acssynbio.6b00279 PubMed 28771312