-
PurposeLentiviral expression of doxycycline-inducible dominant negative RhoA and co-expression of Venus
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser (Addgene plasmid # 25734)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersVenus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRhoA
-
SpeciesH. sapiens (human)
-
MutationDominant Negative
-
Entrez GeneRHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
- 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert contains T19N in RhoA insert compared to best match reference sequence (NP_001655.1)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK DN RhoA was a gift from Sanjay Kumar (Addgene plasmid # 84646 ; http://n2t.net/addgene:84646 ; RRID:Addgene_84646) -
For your References section:
Simultaneous and independent tuning of RhoA and Rac1 activity with orthogonally inducible promoters. MacKay JL, Kumar S. Integr Biol (Camb). 2014 Sep;6(9):885-94. doi: 10.1039/c4ib00099d. 10.1039/c4ib00099d PubMed 25044255