Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84647)


Item Catalog # Description Quantity Price (USD)
Plasmid 84647 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Iain Fraser (Addgene plasmid # 25734)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    myosin light chain kinase
  • Species
    H. sapiens (human)
  • Mutation
    Constitutive Active
  • Entrez Gene
    MYLK (a.k.a. AAT7, KRP, MLCK, MLCK1, MLCK108, MLCK210, MMIHS, MSTP083, MYLK1, smMLCK)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
  • 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The MLCK insert starts at amino acid 885 and contains D899E, D914A, N1782T, K1785R, and S1788T amino acid mutations compared to best match reference sequence (NP_444253.3).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK CA MLCK was a gift from Sanjay Kumar (Addgene plasmid # 84647 ; ; RRID:Addgene_84647)
  • For your References section:

    Constitutive activation of myosin-dependent contractility sensitizes glioma tumor-initiating cells to mechanical inputs and reduces tissue invasion. Wong SY, Ulrich TA, Deleyrolle LP, MacKay JL, Lin JM, Martuscello RT, Jundi MA, Reynolds BA, Kumar S. Cancer Res. 2015 Mar 15;75(6):1113-22. doi: 10.1158/0008-5472.CAN-13-3426. Epub 2015 Jan 29. 10.1158/0008-5472.CAN-13-3426 PubMed 25634210