-
PurposeLentiviral expression of doxycycline-inducible constitutively active MLCK and co-expression of Venus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser (Addgene plasmid # 25734)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersVenus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMLCK
-
Alt namemyosin light chain kinase
-
SpeciesH. sapiens (human)
-
MutationConstitutive Active
-
Entrez GeneMYLK (a.k.a. AAT7, KRP, MLCK, MLCK1, MLCK108, MLCK210, MMIHS, MMIHS1, MSTP083, MYLK-L, MYLK1, smMLCK)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
- 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The MLCK insert starts at amino acid 885 and contains D899E, D914A, N1782T, K1785R, and S1788T amino acid mutations compared to best match reference sequence (NP_444253.3).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK CA MLCK was a gift from Sanjay Kumar (Addgene plasmid # 84647 ; http://n2t.net/addgene:84647 ; RRID:Addgene_84647) -
For your References section:
Constitutive activation of myosin-dependent contractility sensitizes glioma tumor-initiating cells to mechanical inputs and reduces tissue invasion. Wong SY, Ulrich TA, Deleyrolle LP, MacKay JL, Lin JM, Martuscello RT, Jundi MA, Reynolds BA, Kumar S. Cancer Res. 2015 Mar 15;75(6):1113-22. doi: 10.1158/0008-5472.CAN-13-3426. Epub 2015 Jan 29. 10.1158/0008-5472.CAN-13-3426 PubMed 25634210