Skip to main content
Addgene

deltaCT S6K1 MSCV puro
(Plasmid #8465)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 8465 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mscv puro
  • Backbone manufacturer
    bd biosciences
  • Backbone size w/o insert (bp) 6300
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    delta ct p70 S6K1
  • Alt name
    p70S6K1
  • Alt name
    delta ct 104
  • Alt name
    delta 104
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1200
  • Mutation
    deletion of 104 c-terminal amino acids
  • Entrez Gene
    Rps6kb1 (a.k.a. p70 S6K-alpha)
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site sal (not destroyed)
  • 3′ cloning site not (not destroyed)
  • 5′ sequencing primer MSCV (CCCTTGAACCTCCTCGTTCGACC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    joe avruch

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    deltaCT S6K1 MSCV puro was a gift from David Sabatini (Addgene plasmid # 8465 ; http://n2t.net/addgene:8465 ; RRID:Addgene_8465)
  • For your References section:

    Structure of S6K1 determines if raptor-mTOR or rictor-mTOR phosphorylates its hydrophobic motif site. Ali SM, Sabatini DM. J Biol Chem 2005 Apr 4;. 10.1074/jbc.C500125200 PubMed 15809305