pQCXIP-Laforin Myc K320A
(Plasmid
#84669)
-
Purposemammalian expression and/or retrovirus preparation
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQCXIP
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLaforin
-
SpeciesH. sapiens (human)
-
Entrez GeneEPM2A (a.k.a. EPM2, MELF)
- Promoter 5'LTR
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCCATCCACGCTGTTTTGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIP-Laforin Myc K320A was a gift from Ayano Satoh (Addgene plasmid # 84669 ; http://n2t.net/addgene:84669 ; RRID:Addgene_84669) -
For your References section:
S-nitrosylation of laforin inhibits its phosphatase activity and is implicated in Lafora disease. Toyota R, Honjo Y, Imajo R, Satoh A. Sciencematters 10.19185/matters.201606000014