Skip to main content

pAav-TP53-PQS1-3xFLAG
(Plasmid #84884)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84884 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAav-MCS-PQS1-3xFLAG
  • Backbone manufacturer
    Eyckerman lab
  • Backbone size w/o insert (bp) 4863
  • Total vector size (bp) 7031
  • Vector type
    AAV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TP53 genomic region HR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1090
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter no
  • Tag / Fusion Protein
    • PQS1 3xFLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTCTGACTTGAGCGTCGAT
  • 3′ sequencing primer TAGGGCGCGATAACTTCGTA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TP53 genomic region HR2
  • Species
    H. sapiens (human)
  • Promoter no

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGGAGGATTGGGAAGACAAT
  • 3′ sequencing primer TACTATGGTTGCTTTGACGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a targeting vector for modifying the C-terminus of the TP53 gene by adding two tags. A CRE-removable selection cassette is present.
The forward sequencing primer needs to sequence over an ITR sequence which can be problematic

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAav-TP53-PQS1-3xFLAG was a gift from Sven Eyckerman (Addgene plasmid # 84884 ; http://n2t.net/addgene:84884 ; RRID:Addgene_84884)
  • For your References section:

    An extra dimension in protein tagging by quantifying universal proteotypic peptides using targeted proteomics. Vandemoortele G, Staes A, Gonnelli G, Samyn N, De Sutter D, Vandermarliere E, Timmerman E, Gevaert K, Martens L, Eyckerman S. Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220. 10.1038/srep27220 PubMed 27264994