Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAav-IQGAP1-PQS1-3xFLAG
(Plasmid #84885)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84885 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS-PQS1-3xFLAG
  • Backbone manufacturer
    Eyckerman lab
  • Backbone size w/o insert (bp) 4863
  • Total vector size (bp) 7039
  • Vector type
    AAV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    IQGAP1 genomic region HR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1011
  • GenBank ID
    NM_003870.3
  • Entrez Gene
    IQGAP1 (a.k.a. HUMORFA01, SAR1, p195)
  • Promoter no
  • Tag / Fusion Protein
    • PQS1 3xFLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTCTGACTTGAGCGTCGAT
  • 3′ sequencing primer TAGGGCGCGATAACTTCGTA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    IQGAP1 genomic region HR2
  • Insert Size (bp)
    1238
  • GenBank ID
    NM_003870.3
  • Promoter no

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGGAGGATTGGGAAGACAAT
  • 3′ sequencing primer TACTATGGTTGCTTTGACGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sequencing over ITRs is difficult

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAav-IQGAP1-PQS1-3xFLAG was a gift from Sven Eyckerman (Addgene plasmid # 84885 ; http://n2t.net/addgene:84885 ; RRID:Addgene_84885)
  • For your References section:

    An extra dimension in protein tagging by quantifying universal proteotypic peptides using targeted proteomics. Vandemoortele G, Staes A, Gonnelli G, Samyn N, De Sutter D, Vandermarliere E, Timmerman E, Gevaert K, Martens L, Eyckerman S. Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220. 10.1038/srep27220 PubMed 27264994