pAav-MDM2-PQS2-3xHA
(Plasmid
#84886)
-
PurposerAAV-based template for genome engineering of the MDM2 protein C-terminus containing PQS2 and 3xHA tags and a selection cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAav-MCS-PQS2-3xHA
-
Backbone manufacturerEyckerman lab
- Backbone size w/o insert (bp) 4890
- Total vector size (bp) 6877
-
Vector typeAAV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMDM2 genomic sequence HR1
-
Alt nameHDM2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1020
-
Entrez GeneMDM2 (a.k.a. ACTFS, HDMX, LSKB, hdm2)
- Promoter no
-
Tag
/ Fusion Protein
- PQS2 3xHA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCTCTGACTTGAGCGTCGAT
- 3′ sequencing primer TAGGGCGCGATAACTTCGTA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMDM2 genomic insert HR2
-
Alt nameHDM2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1008
-
Entrez GeneMDM2 (a.k.a. ACTFS, HDMX, LSKB, hdm2)
- Promoter no
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGGAGGATTGGGAAGACAAT
- 3′ sequencing primer TACTATGGTTGCTTTGACGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequencing over ITR sequences may be difficult
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAav-MDM2-PQS2-3xHA was a gift from Sven Eyckerman (Addgene plasmid # 84886 ; http://n2t.net/addgene:84886 ; RRID:Addgene_84886) -
For your References section:
An extra dimension in protein tagging by quantifying universal proteotypic peptides using targeted proteomics. Vandemoortele G, Staes A, Gonnelli G, Samyn N, De Sutter D, Vandermarliere E, Timmerman E, Gevaert K, Martens L, Eyckerman S. Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220. 10.1038/srep27220 PubMed 27264994