Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Banshee-ShCit-A
(Plasmid #85216)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85216 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Banshee-GFP
  • Backbone size w/o insert (bp) 6530
  • Modifications to backbone
    H1 promoter to drive hairpin expression was inserted upstream of hairpin cloning sites and cannot be removed. Hairpin can be excised with Bgl2 and Hind3 digest.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shCit-A
  • gRNA/shRNA sequence
    GACGACATGCACCATGCTGTTCAAGAGACAGCATGGTGCATGTCGTCTTTTT
  • Species
    M. musculus (mouse)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl2 (not destroyed)
  • 3′ cloning site Hind3 (unknown if destroyed)
  • 5′ sequencing primer gaacgctgacgtcatcaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Banshee-ShCit-A was a gift from Alex Minella (Addgene plasmid # 85216 ; http://n2t.net/addgene:85216 ; RRID:Addgene_85216)
  • For your References section:

    E2F-2 promotes nuclear condensation and enucleation of terminally differentiated erythroblasts. Swartz KL, Wood SN, Murthy T, Ramirez O, Qin G, Pillai MM, Rao S, Minella AC. Mol Cell Biol. 2016 Oct 17. pii: MCB.00274-16. 10.1128/MCB.00274-16 PubMed 27795297