pAAV CAG ChR2 E123T T159C 2A tDimer
(Plasmid
#85399)
-
PurposeHigh efficiency channelrhodopsin with cytomegalovirus enhancer fused to chicken β-actin (CAG) promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5802
- Total vector size (bp) 8244
-
Modifications to backboneInserted CAG promoter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin-2
-
Alt nameChR2
-
SpeciesChlamydomonas
-
Insert Size (bp)1725
-
MutationE123T , T159C
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tttcgccacctctgactt
- 3′ sequencing primer CAGCCGCAGGTTGACTTCCATG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametdimer2
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1395
- Promoter ribosomal skip sequence 2A
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe CAG Promoter was taken from Addgene #11160 ChR2 was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Layer-specific optogenetic activation of pyramidal neurons causes beta-gamma entrainment of neonatal networks.
Nat Commun. 2017 Feb 20;8:14563. doi: 10.1038/ncomms14563.
Bitzenhofer SH1, Ahlbeck J1, Wolff A1, Wiegert JS2, Gee CE2, Oertner TG2, Hanganu-Opatz IL1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV CAG ChR2 E123T T159C 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85399 ; http://n2t.net/addgene:85399 ; RRID:Addgene_85399) -
For your References section:
High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels. Berndt A, Schoenenberger P, Mattis J, Tye KM, Deisseroth K, Hegemann P, Oertner TG. Proc Natl Acad Sci U S A. 2011 May 3;108(18):7595-600. doi: 10.1073/pnas.1017210108. Epub 2011 Apr 19. 10.1073/pnas.1017210108 PubMed 21504945