pAAV CAG ChR2 E123T T159C 2A tDimer
(Plasmid #85399)

• Purpose: High efficiency channelrhodopsin with cytomegalovirus enhancer fused to chicken β-actin (CAG) promoter
• Depositing Lab: Thomas Oertner
• Publication: Berndt et al Proc Natl Acad Sci U S A. 2011 May 3;108(18):7595-600. doi: 10.1073/pnas.1017210108. Epub 2011 Apr 19.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5802
• Total vector size (bp): 8244
• Modifications to backbone: Inserted CAG promoter
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Channelrhodopsin-2
• Alt name: ChR2
• Species: Chlamydomonas
• Insert Size (bp): 1725
• Mutation: E123T , T159C
• Promoter: CAG

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: tttcgccacctctgactt
• 3′ sequencing primer: CAGCCGCAGGTTGACTTCCATG

Gene/Insert 2

• Gene/Insert name: red fluorescent protein
• Alt name: tdimer2
• Species: Discosoma sp.
• Insert Size (bp): 1395
• Promoter: ribosomal skip sequence 2A

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GGCAGAGGAAGTCTTCTAACAT
• 3′ sequencing primer: GTAATCCAGAGGTTGATTATCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The CAG Promoter was taken from Addgene #11160 ChR2 was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Layer-specific optogenetic activation of pyramidal neurons causes beta-gamma entrainment of neonatal networks.

Nat Commun. 2017 Feb 20;8:14563. doi: 10.1038/ncomms14563.

Bitzenhofer SH1, Ahlbeck J1, Wolff A1, Wiegert JS2, Gee CE2, Oertner TG2, Hanganu-Opatz IL1.