Skip to main content

pMXs-WT-ATPIF1
(Plasmid #85403)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85403 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs rtv-016
  • Backbone size w/o insert (bp) 5600
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATPIF1
  • Species
    H. sapiens (human)
  • Mutation
    Wildtype
  • Entrez Gene
    ATP5IF1 (a.k.a. ATPI, ATPIF1, ATPIP, IP)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-WT-ATPIF1 was a gift from David Sabatini (Addgene plasmid # 85403 ; http://n2t.net/addgene:85403 ; RRID:Addgene_85403)
  • For your References section:

    Inhibition of ATPIF1 ameliorates severe mitochondrial respiratory chain dysfunction in mammalian cells. Chen WW, Birsoy K, Mihaylova MM, Snitkin H, Stasinski I, Yucel B, Bayraktar EC, Carette JE, Clish CB, Brummelkamp TR, Sabatini DD, Sabatini DM. Cell Rep. 2014 Apr 10;7(1):27-34. doi: 10.1016/j.celrep.2014.02.046. Epub 2014 Mar 27. 10.1016/j.celrep.2014.02.046 PubMed 24685140