pMXs-WT-ATPIF1
(Plasmid
#85403)
-
PurposeRetroviral vector expressing wild type human ATPIF1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs rtv-016
- Backbone size w/o insert (bp) 5600
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATPIF1
-
SpeciesH. sapiens (human)
-
MutationWildtype
-
Entrez GeneATP5IF1 (a.k.a. ATPI, ATPIF1, ATPIP, IP)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-WT-ATPIF1 was a gift from David Sabatini (Addgene plasmid # 85403 ; http://n2t.net/addgene:85403 ; RRID:Addgene_85403) -
For your References section:
Inhibition of ATPIF1 ameliorates severe mitochondrial respiratory chain dysfunction in mammalian cells. Chen WW, Birsoy K, Mihaylova MM, Snitkin H, Stasinski I, Yucel B, Bayraktar EC, Carette JE, Clish CB, Brummelkamp TR, Sabatini DD, Sabatini DM. Cell Rep. 2014 Apr 10;7(1):27-34. doi: 10.1016/j.celrep.2014.02.046. Epub 2014 Mar 27. 10.1016/j.celrep.2014.02.046 PubMed 24685140
Map uploaded by the depositor.