Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SHP2(T253M/Q257L)@pLKO-Trex-SBP
(Plasmid #85458)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85458 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO-trex-SBP-DEST-Neo
  • Backbone size w/o insert (bp) 9600
  • Total vector size (bp) 11700
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SHP2
  • Alt name
    PTPN11
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2200
  • Mutation
    T253M/Q257L
  • Entrez Gene
    PTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)
  • Promoter RSV
  • Tag / Fusion Protein
    • SBP Tag (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGACATCGCGGAGATGGTTTCACC
  • 3′ sequencing primer TCATCTGAAACTTTTCTGCTGTTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SHP2(T253M/Q257L)@pLKO-Trex-SBP was a gift from Darrin Stuart (Addgene plasmid # 85458 ; http://n2t.net/addgene:85458 ; RRID:Addgene_85458)
  • For your References section:

    Allosteric inhibition of SHP2 phosphatase inhibits cancers driven by receptor tyrosine kinases. Chen YN, LaMarche MJ, Chan HM, Fekkes P, Garcia-Fortanet J, Acker MG, Antonakos B, Chen CH, Chen Z, Cooke VG, Dobson JR, Deng Z, Fei F, Firestone B, Fodor M, Fridrich C, Gao H, Grunenfelder D, Hao HX, Jacob J, Ho S, Hsiao K, Kang ZB, Karki R, Kato M, Larrow J, La Bonte LR, Lenoir F, Liu G, Liu S, Majumdar D, Meyer MJ, Palermo M, Perez L, Pu M, Price E, Quinn C, Shakya S, Shultz MD, Slisz J, Venkatesan K, Wang P, Warmuth M, Williams S, Yang G, Yuan J, Zhang JH, Zhu P, Ramsey T, Keen NJ, Sellers WR, Stams T, Fortin PD. Nature. 2016 Jul 7;535(7610):148-52. 10.1038/nature18621 PubMed 27362227