Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85467)


Item Catalog # Description Quantity Price (USD)
Plasmid 85467 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5660
  • Modifications to backbone
    EGFP has been replaced by inserting the complete fusion construct (ChR2-mCherry) using XbaI and BamHI cloning sites
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    Synthetic; Chlamydomonas reinhardtii
  • Insert Size (bp)
  • Mutation
    E83Q, E90R, E101S, T159C, D156N
  • GenBank ID
  • Promoter CMV (+enhancer)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 3′ sequencing primer EGFP-C1-R: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-mCherry-N1-iChloC was a gift from Peter Hegemann (Addgene plasmid # 85467 ; ; RRID:Addgene_85467)
  • For your References section:

    An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Simon Wiegert J. Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807. 10.1038/srep14807 PubMed 26443033