sgTP53(A)
(Plasmid
#85559)
-
PurposeExpresses sgRNA targeting human TP53 around codon F109
-
Depositing Lab
-
Depositing OrganizationINSERM U982, Génomique fonctionnelle et physiopathologie neuronale et neuroendocrine
Located in France -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85559 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 85559-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 85559-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459)
-
Backbone manufacturerFeng Zhang
- Total vector size (bp) 9200
-
Modifications to backboneinsertion of a sgRNA sequence targeting TP53
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametumor protein p53
-
gRNA/shRNA sequenceGGGCAGCTACGGTTTCCGTC
-
SpeciesH. sapiens (human)
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 85559-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 85559-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgTP53(A) was a gift from Luca Grumolato (Addgene plasmid # 85559 ; http://n2t.net/addgene:85559 ; RRID:Addgene_85559) -
For your References section:
CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Guernet A, Mungamuri SK, Cartier D, Sachidanandam R, Jayaprakash A, Adriouch S, Vezain M, Charbonnier F, Rohkin G, Coutant S, Yao S, Ainani H, Alexandre D, Tournier I, Boyer O, Aaronson SA, Anouar Y, Grumolato L. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. 10.1016/j.molcel.2016.06.017 PubMed 27453044