-
PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experiments
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140690 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePB-TRE-dCas9-KRAB-MeCP2
-
Backbone manufacturerAndrea Califano
- Total vector size (bp) 16734
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9m4-KRAB-MeCP2
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCCAAATTCTCGATTCACGC
- 3′ sequencing primer CTCGGTGGGGTATCGACAGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChavez et al Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a lentiviral vector (modified in #122205; originally from Weissman lab #85969) with a Tet-ON 3G dCas9m4-KRAB-MeCP2 (Church lab; #63800). Note: the vector has been modified to use blasticidin selection.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX-TRE-dCas9-KRAB-MeCP2-BSD was a gift from Andrea Califano (Addgene plasmid # 140690 ; http://n2t.net/addgene:140690 ; RRID:Addgene_140690)