pSico shMAPKAPK3 human
              
              
                (Plasmid
                
                #85661)
              
            
            
            
          - 
            Purposeexpression of shRNA targeting human MAPKAPK3
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85661 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSico
- 
              Vector typeMammalian Expression, Lentiviral, RNAi
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameMAPKAPK3
- 
                    gRNA/shRNA sequenceTGCTAAGTGGCTTCCCATTATTCAAGAGATAATGGGAAGCCACTTAGCTTTTTTC
- 
                    SpeciesH. sapiens (human)
- 
                        Entrez GeneMAPKAPK3 (a.k.a. 3PK, MAPKAP-K3, MAPKAP3, MAPKAPK-3, MDPT3, MK-3)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer mU6-F (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSico shMAPKAPK3 human was a gift from Julien Sage (Addgene plasmid # 85661 ; http://n2t.net/addgene:85661 ; RRID:Addgene_85661)
- 
                For your References section: Coordination of stress signals by the lysine methyltransferase SMYD2 promotes pancreatic cancer. Reynoird N, Mazur PK, Stellfeld T, Flores NM, Lofgren SM, Carlson SM, Brambilla E, Hainaut P, Kaznowska EB, Arrowsmith CH, Khatri P, Stresemann C, Gozani O, Sage J. Genes Dev. 2016 Apr 1;30(7):772-85. doi: 10.1101/gad.275529.115. Epub 2016 Mar 17. 10.1101/gad.275529.115 PubMed 26988419
