-
Purpose(Empty Backbone) Backbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with a BFP fluorescent marker. Does NOT include Cas9.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 85707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHKO9
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer ataatgatagtaggaggcttgg
- 3′ sequencing primer gagtttggacaaaccacaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPseq-BFP-backbone was a gift from Ido Amit (Addgene plasmid # 85707 ; http://n2t.net/addgene:85707 ; RRID:Addgene_85707) -
For your References section:
Dissecting Immune Circuits by Linking CRISPR-Pooled Screens with Single-Cell RNA-Seq. Jaitin DA, Weiner A, Yofe I, Lara-Astiaso D, Keren-Shaul H, David E, Salame TM, Tanay A, van Oudenaarden A, Amit I. Cell. 2016 Dec 15;167(7):1883-1896.e15. doi: 10.1016/j.cell.2016.11.039. 10.1016/j.cell.2016.11.039 PubMed 27984734