pSH-Csy4-T2A-SaRFN
(Plasmid
#85755)
-
PurposeExpresses S.aureus FokI-dCas9-NLS with a 36 amino acid GSAT linker fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Backbone derived from pSQT1601 (Addgene #53369).
-
Depositing Lab
-
Depositing OrganizationGenome Institute of Singapore, A*STAR Research Entities
Located in Singapore -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSQT-1601
-
Backbone manufacturerShengdar Q Tsai from Keith Joung lab
- Backbone size w/o insert (bp) 4833
- Total vector size (bp) 9471
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCsy4-T2A-FokI-SadCas9
-
Alt nameRNA-guided FokI-nuclease
-
Alt nameSaRFN
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)4638
-
MutationD10A, N580A
- Promoter CAG
-
Tags
/ Fusion Proteins
- FokI fusion via 36 amino acid GSAT linker (N terminal on insert)
- Csy4 (N terminal on backbone)
- 3xHA tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAGCCTCTGCTAACCATGTTC
- 3′ sequencing primer ttttggcagagggaaaaaga
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byS.a. Cas9 derived from plasmid pX601 (Addgene 61591).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH-Csy4-T2A-SaRFN was a gift from Lawrence Stanton (Addgene plasmid # 85755 ; http://n2t.net/addgene:85755 ; RRID:Addgene_85755) -
For your References section:
Re-engineered RNA-Guided FokI-Nucleases for Improved Genome Editing in Human Cells. Havlicek S, Shen Y, Alpagu Y, Bruntraeger MB, Zufir NB, Phuah ZY, Fu Z, Dunn NR, Stanton LW. Mol Ther. 2017 Feb 1;25(2):342-355. doi: 10.1016/j.ymthe.2016.11.007. 10.1016/j.ymthe.2016.11.007 PubMed 28153087