Skip to main content

pX330-sgAAVS1
(Plasmid #85802)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85802 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Feng Zhang laboratory (Addgene Plasmid #42230 )
  • Backbone size w/o insert (bp) 8488
  • Total vector size (bp) 8508
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPP1R12C
  • Alt name
    AAVS1 insertion site (gene symbol PPP1R12C)
  • gRNA/shRNA sequence
    GGGGCCACTAGGGACAGGAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    PPP1R12C (a.k.a. AAVS1, LENG3, MBS85, p84, p85)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6-fwd
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-sgAAVS1 was a gift from Roland Friedel (Addgene plasmid # 85802 ; http://n2t.net/addgene:85802 ; RRID:Addgene_85802)
  • For your References section:

    Gene signatures of quiescent glioblastoma cells reveal mesenchymal shift and interactions with niche microenvironment. Tejero R, Huang Y, Katsyv I, Kluge M, Lin JY, Tome-Garcia J, Daviaud N, Wang Y, Zhang B, Tsankova NM, Friedel CC, Zou H, Friedel RH. EBioMedicine. 2019 Apr 2. pii: S2352-3964(19)30209-9. doi: 10.1016/j.ebiom.2019.03.064. 10.1016/j.ebiom.2019.03.064 PubMed 30952620