AB.pCCL.sin.cPPT.GFP.miR-194-3p.sensor.PGK.dNGFR.WPRE
(Plasmid
#85929)
-
PurposeSensor Plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAB.pCCL.sin.cPPT.GFP.PGK.dNGFR.WPRE
- Backbone size w/o insert (bp) 9309
- Total vector size (bp) 9480
-
Vector typeLentiviral
-
Selectable markerseGFP , NGFR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-194-3p Sensor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)171
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer AACAGACATACAAACTAAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AB.pCCL.sin.cPPT.GFP.miR-194-3p.sensor.PGK.dNGFR.WPRE was a gift from Brian Brown (Addgene plasmid # 85929 ; http://n2t.net/addgene:85929 ; RRID:Addgene_85929) -
For your References section:
High-throughput assessment of microRNA activity and function using microRNA sensor and decoy libraries. Mullokandov G, Baccarini A, Ruzo A, Jayaprakash AD, Tung N, Israelow B, Evans MJ, Sachidanandam R, Brown BD. Nat Methods. 2012 Jul 1;9(8):840-6. doi: 10.1038/nmeth.2078. 10.1038/nmeth.2078 PubMed 22751203