Skip to main content

pOP462
(Plasmid #85935)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85935 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Unknown
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Anti-Ebola 13C6 monoclonal antibody
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Promoter AOX1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctggttccaattgacaagcttttgattttaacg
  • 3′ sequencing primer 3_AOX1_primer (gcaaatggcattctgacatcc)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOP462 was a gift from Timothy Lu (Addgene plasmid # 85935 ; http://n2t.net/addgene:85935 ; RRID:Addgene_85935)
  • For your References section:

    Production of Functional Anti-Ebola Antibodies in Pichia pastoris. Purcell O, Opdensteinen P, Chen W, Lowenhaupt K, Brown A, Hermann M, Cao J, Tenhaef N, Kallweit E, Kastilan R, Sinskey AJ, Perez-Pinera P, Buyel JF, Lu TK. ACS Synth Biol. 2017 Aug 17. doi: 10.1021/acssynbio.7b00234. 10.1021/acssynbio.7b00234 PubMed 28786662