pICH47732:FCP:ShBle
(Plasmid
#85985)
-
PurposeExpresses ShBle with FCP promoter/terminator for F. cylindrus transformation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85985 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepICH47732
-
Backbone manufacturerSylvestre Marillonnet (Addgene #48000)
-
Vector typeGolden Gate Assembly
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameShBle
- Promoter FCP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Zeo-R (ctgatgaacagggtcacgtc) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe FCP promoter and terminator were amplified from Fragilariopsis cylindrus gDNA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The FCP promoter and terminator were amplified from Fragilariopsis cylindrus gDNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH47732:FCP:ShBle was a gift from Thomas Mock (Addgene plasmid # 85985 ; http://n2t.net/addgene:85985 ; RRID:Addgene_85985)