Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC:FCP:ShBle:FCP:EGFP
(Plasmid #85987)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85987 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Unknown
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    ShBle
  • Alt name
    Zeocin resistance
  • Promoter FCP

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Species
    jellyfish
  • Promoter FCP

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer EXFP-R
  • 3′ sequencing primer EXFP-internal-F (ACGACGGCAACTACAAGACC)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The FCP promoter and terminator were amplified from Fragilariopsis cylindrus gDNA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC:FCP:ShBle:FCP:EGFP was a gift from Thomas Mock (Addgene plasmid # 85987 ; http://n2t.net/addgene:85987 ; RRID:Addgene_85987)