pUC:FCP:ShBle:FCP:EGFP
(Plasmid
#85987)
-
PurposeExpresses ShBle and EGFP with FCP promoters/terminators for F. cylindrus transformation.
-
Depositing Lab
-
Depositing OrganizationUniversity of East Anglia
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneUnknown
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameShBle
-
Alt nameZeocin resistance
- Promoter FCP
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer Zeo-R (ctgatgaacagggtcacgtc)
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
Speciesjellyfish
- Promoter FCP
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer EXFP-R
- 3′ sequencing primer EXFP-internal-F (ACGACGGCAACTACAAGACC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe FCP promoter and terminator were amplified from Fragilariopsis cylindrus gDNA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC:FCP:ShBle:FCP:EGFP was a gift from Thomas Mock (Addgene plasmid # 85987 ; http://n2t.net/addgene:85987 ; RRID:Addgene_85987) -
For your References section:
Genetic tool development in marine protists: emerging model organisms for experimental cell biology. Faktorova D, Nisbet RER, Fernandez Robledo JA, Casacuberta E, Sudek L, Allen AE, Ares M Jr, Areste C, Balestreri C, Barbrook AC, Beardslee P, Bender S, Booth DS, Bouget FY, Bowler C, Breglia SA, Brownlee C, Burger G, Cerutti H, Cesaroni R, Chiurillo MA, Clemente T, Coles DB, Collier JL, Cooney EC, Coyne K, Docampo R, Dupont CL, Edgcomb V, Einarsson E, Elustondo PA, Federici F, Freire-Beneitez V, Freyria NJ, Fukuda K, Garcia PA, Girguis PR, Gomaa F, Gornik SG, Guo J, Hampl V, Hanawa Y, Haro-Contreras ER, Hehenberger E, Highfield A, Hirakawa Y, Hopes A, Howe CJ, Hu I, Ibanez J, Irwin NAT, Ishii Y, Janowicz NE, Jones AC, Kachale A, Fujimura-Kamada K, Kaur B, Kaye JZ, Kazana E, Keeling PJ, King N, Klobutcher LA, Lander N, Lassadi I, Li Z, Lin S, Lozano JC, Luan F, Maruyama S, Matute T, Miceli C, Minagawa J, Moosburner M, Najle SR, Nanjappa D, Nimmo IC, Noble L, Novak Vanclova AMG, Nowacki M, Nunez I, Pain A, Piersanti A, Pucciarelli S, Pyrih J, Rest JS, Rius M, Robertson D, Ruaud A, Ruiz-Trillo I, Sigg MA, Silver PA, Slamovits CH, Jason Smith G, Sprecher BN, Stern R, Swart EC, Tsaousis AD, Tsypin L, Turkewitz A, Turnsek J, Valach M, Verge V, von Dassow P, von der Haar T, Waller RF, Wang L, Wen X, Wheeler G, Woods A, Zhang H, Mock T, Worden AZ, Lukes J. Nat Methods. 2020 May;17(5):481-494. doi: 10.1038/s41592-020-0796-x. Epub 2020 Apr 6. 10.1038/s41592-020-0796-x PubMed 32251396