-
Purposeexpresses flag tagged Ets1 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 7500
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEts1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2296
-
GenBank IDBC010588 BC010588
-
Entrez GeneEts1 (a.k.a. D230050P06, Ets-1, Tpl1, p54, vs)
-
Tag
/ Fusion Protein
- Flag tag; kanamycin selection
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nsi1 (unknown if destroyed)
- 3′ cloning site Apa1 (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-mFlagEts1 was a gift from Barbara Graves (Addgene plasmid # 86099 ; http://n2t.net/addgene:86099 ; RRID:Addgene_86099) -
For your References section:
An ERK2 docking site in the Pointed domain distinguishes a subset of ETS transcription factors. Seidel JJ, Graves BJ. Genes Dev. 2002 Jan 1;16(1):127-37. 10.1101/gad.950902 PubMed 11782450