Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV-mFlagEts1
(Plasmid #86099)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86099 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 7500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ets1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2296
  • GenBank ID
    BC010588 BC010588
  • Entrez Gene
    Ets1 (a.k.a. AI196000, AI448617, D230050P06, Ets-1, Tpl1, p54, vs)
  • Tag / Fusion Protein
    • Flag tag; kanamycin selection

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nsi1 (unknown if destroyed)
  • 3′ cloning site Apa1 (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-mFlagEts1 was a gift from Barbara Graves (Addgene plasmid # 86099 ; http://n2t.net/addgene:86099 ; RRID:Addgene_86099)
  • For your References section:

    An ERK2 docking site in the Pointed domain distinguishes a subset of ETS transcription factors. Seidel JJ, Graves BJ. Genes Dev. 2002 Jan 1;16(1):127-37. 10.1101/gad.950902 PubMed 11782450