plentiCRISPRv2-sgEGFP
(Plasmid #86153)

• Purpose: Lentivirus carrying Cas9/CRISPR for cut in GFP (used as control)
• Depositing Lab: Roland Friedel
• Publication: Huang et al Commun Biol. 2021 Jan 29;4(1):145. doi: 10.1038/s42003-021-01667-4.

Backbone

• Vector backbone: plentiCRISPRv2
• Backbone manufacturer: Feng Zhang laboratory, MIT
• Backbone size w/o insert (bp): 12992
• Total vector size (bp): 13012
• Vector type: Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• gRNA/shRNA sequence: GGGCGAGGAGCTGTTCACCG
• Species: Synthetic

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: U6-fwd

Resource Information

• Supplemental Documents:
  • Lentivirus lentiCRISPRv2 structure
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This lenti-CRISPRv2 vector was used as control for studies with gene specific lenti-CRISPRv2 gene deletion of Plexin-B2 in human cells (plentiCRISPRv2-sgPLXNB2).

Plasmid received from Jialiang Liang, Laboratory of Patrizia Casaccia, Icahn School of Medicine at Mount Sinai